ЗООИНФОРМ-СИТИ
zooinform.ru
ЗООИНФОРМ-СИТИ
Ветеринария
Статьи по разделам
Вход для зарегистрированных пользователей
ЗАРЕГИСТРИРОВАТЬСЯ
Войти через
НАВЕРХ
Наши партнеры

Статьи по разделам
Оглавление раздела
02.04.2017.

Бактерии рода Campylobacter и нейтрофильное воспаление кишечника у кошек

 

 

C.L. Maunder, Z.F. Reynolds, L. Peacock, E.J. Hall, M.J. Day, and T.A. Cogan
School of Veterinary Sciences, University of Bristol, Langford, UK

 

 


Работа в рамках данного исследования проводилась в Школе ветеринарных наук Бристольского университета (School of Veterinary Sciences, University of Bristol) при поддержке гранта от Лэнгфордского Траста (Langford Trust). Материал, описанный в данной статье, был представлен на Конгрессе Европейского колледжа ветеринарной медицины в Лиссабоне (European College of Veterinary Internal Medicine Congress), Португалия, в 2015 году.


 

Сокращения:

12-LOX — 12-липоксигеназа
AIEC — адгезивные и инвазивные E. coli
ДНК — дезоксирибонуклеиновая кислота (ДНК)
FCEAI — индекс активности хронической энтеропатии у кошек
FISH — флюоресцентная гибридизация in situ
H & E — гематоксилин- эозин
HPF — поле зрения при большом увеличении
ВЗК — воспалительное(-ые) заболевание(-я) кишечника (ВЗК)
IL-8 — интерлейкин-8
NF-B — ядерный фактор каппа бета
ПЦР — полимеразная цепная реакция (ПЦР)
rRNA — 16S- рибосомальная рибонуклеиновая кислота
WSAVA — Всемирная ветеринарная ассоциация по мелким животным

 

 

Воспалительные заболевания кишечника являются частой причиной хронической симптоматики у кошек с болезнями желудочно-кишечного тракта [1]. Для подтверждения факта воспалительного процесса в кишечнике требуется проводить биопсию, но зачастую первичную причину процесса выявить не удаётся, и такие случаи причисляют к идиопатическим [1–3]. Для этого типичен лимфоплазмоцитарный характер воспаления в образцах биопсии, но у части кошек, страдающих ВЗК, обнаруживается нейтрофильное воспаление слизистой кишечника. Причины нейтрофильного воспаления не ясны. Оно может возникать вследствие бактериальной инфекции, но нейтрофильный колит выявлялся у кошек с инфекцией Tritrichomonas foetus [4], а также в одном описанном случае [5], где бактериальной инфекции найдено не было. Рыхлая консистенция и изъязвлённость слизистой тоже может быть причиной нейтрофильной инфильтрации в связи с потерей целостности слизистого барьера. Если первичный этиологический агент не удаётся выявить, возникают сложности с назначением адекватной терапии; в таких случаях можно прибегнуть к эмпирической антибактериальной терапии.

С помощью традиционных диагностических техник достаточно сложно найти первопричину нейтрофильного воспаления слизистой кишечника. Клиническая релевантость анализа кала в таких случаях низкая, поскольку те же бактерии, которые выявляются у животного с диареей, можно найти и у здорового животного [6–9].

Использование флюоресцентной гибридизации in situ (FISH) даёт возможность найти и визуализировать интактные бактерии внутри тканей и их локализацию, что даёт представление об этиологии процесса [10]. В гастроэнтерологии мелких животных FISH применялась для обнаружения Helicobacter spp. в желудке и контроля эффективности лечения [11], проба позволила наглядно показать, что инвазивный E. coli (AIEC) у боксёров ассоциируется с гранулематозным колитом и поддаётся лечению курсом пролонгированных антибиотиков [12, 13], Janeczko [14] с помощью FISH выявил, что у кошек, страдающих желудочно-кишечными расстройствами, в слизистой кишечника содержится больше энтеробактерий по сравнению со здоровыми кошками, хотя не было точно установлено, является это причиной воспаления или следствием эрозии слизистой вкупе с дисбактериозом.

Целями данного исследования были:

  1. Выявить наличие и идентифицировать интактные бактерии в препаратах с биопсии с помощью FISH.
  2. Определить локализацию нейтрофилов и близость к бактериям, демонстрирующую ассоциацию воспаления с инфекционным процессом и возможную бактериальную этиологию процесса.

 

Материалы и методы

 

Изучение популяции

 

Образцы для изучения были взяты из архива University of Bristol, School of Veterinary Sciences. Критериями включения в исследование было наличие диагноза нейтрофильного либо лимфоплазмоцитарного воспаления в образцах дуоденальной биопсии и их достаточные качество и размер для проведения FISH как минимум на трёх ворсинках с сохранной lamina propria до мышечного слоя.

Этим критериям соответствовали образцы 15 кошек (7 с нейтрофильным ВЗК и 8 с лимфоплазмоцитарным), которые были фиксированы формалином и парафином. В историях болезни были описания симптомов пациентов, но о выраженности симптоматики и реакции на лечение не говорилось. Этическое одобрение для данного исследования было получено от University of Bristol Ethics Committee. Образцы всех кошек были ретроспективно исследованы на предмет наличия кишечных бактериальных агентов с помощью ПЦР.

 

Гистологический анализ

 

В каждом случае образцы, окрашенные гематоксилин-эозином, были исследованы сертифицированным ветеринарным патологоанатомом (MJD) без предварительного ознакомления с историей болезни. Гистологические изменения оценивались по шкале, разработанной WSAVA Gastrointestinal Standardization Group [15]. Оценке подверглись пять признаков воспалительного процесса (интраэпителиальные лимфоциты, лимфоциты собственной пластинки, клетки плазмы, эозинофилы и нейтрофилы и прочие типы участвующих в процессе воспаления клеток). Также были исследованы некоторые морфологические параметры воспаления слизистой (недоразвитие ворсинок, повреждения слизистой, дилатация/деформация крипт, фиброз слизистой). Морфологические изменения отмечались, но значительных отличий между группами не было. В конечном итоге все диагнозы были разделены на 8 групп, в зависимости от гистологической картины: без патологии (NAD), лимфоплазмоцитарное воспаление, эозинофильное воспаление, лимфоангиоэктазия, лимфома, атрофия/фиброз слизистой (не воспалительного характера) и другие. В исследование включались только образцы с лимфоцитарным и нейтрофильным воспалением.

 

 

Таблица 1. Пробы FISH олигонуклеотидов. Детализация последовательности олигонуклеотидов, используемая для локализации бактерий in situ в тканях с дуоденальной биопсии

 

 

Флюоресцентная гибридизация in situ — Бактерии

 

Флюоресцентная гибридизация in situ hybridization (FISH) проводилась на фиксированном в формалине с усилением парафином материале с биопсии с использованием метода, немного отличающегося от ранее описанного в литературе: буфер гибридизации содержал 25% формамид, по сравнению с 30% формамидом в предыдущих исследованиях [16].

Использовались пробы для направленных маркёров флюоресценции олигонуклеотидов 16S-рибосомальной рибонуклеиновой кислоты (таблица 1). Полученные секции с каждой биопсии анализировались в несколько шагов, каждый из которых состоял из разных комбинаций проб. Шаги № 1 и № 2 состояли из проб на Эубактерии и Фирмикуты по три пробы для каждой группы бактерий. Комбинации проб с небольшими вариациями в их проведении использовались, чтобы максимально расширить спектр каждой комбинации. Группа № 3 состояла из специфических проб на Кампилобарии: первая проба на C. upsaliensis, вторая на C. jejuni, последняя — на все термофильные Кампилобактерии. Те бактерии, которые выявлялись только в последней пробе, могли оказаться либо C. lari, либо C. coli, и в дальнейшем подвергались анализу с помощью ПЦР. Мы не проводили отдельного теста на специфические типы C. coli и с помощью данной методики не могли выявить AIEC.

Обработанные слайды были помещены на стекло, обработаны раствором Vectashield с красителем DAPI. Приготовленные стекла были рассмотрены микроскопом Leica DMR-A с монохромной цифровой камерой Hamamatsu 8-bit. Бактериальные клетки подсчитывались в эпителии и собственной пластинке под 400-кратным увеличением «слепым» (не посвящённым в суть исследования в целях сохранения объективности) исследователем на 10 полях зрения, в итоге в расчёт было взято среднее арифметическое количество. Поля зрения выбирались таким образом, чтобы они находились ближе к центру препарата, содержали эпителий и не перекрывали друг друга.

 

Полимеразная цепная реакция (ПЦР)

 

ДНК извлекалась с помощью набора DNeasy™ для крови тканей (Qiagen, Manchester, UK). Далее они проходили скрининг в by Langford Veterinary Services (Bristol, UK) на Сальмонеллы, патогенные E. coli, Кампилобактерии и Клостридии. Фрагмент 153-bp ДНК, уникальный для Кампилобактерий, усиливался с помощью ПЦР [17] и секвенировался для подтверждения соответствия Кампилобактериям.

 

Флюоресцентная гибридизация in situ — близкая локализация бактерий и нейтрофилов

 

Пробы на C. jejuni и термофильные Campylobacter spp. использовались в комбинации с реакцией FISH для выявления нейтрофильной эластазы мРНК кошек. Проба на нейтрофильную эластазу 5’CAGAGGCTGCTGAACGACATCGTGATTCTCCAGCTCAAT3’; проводилась одновременно с пробами для Кампилобактерий (термофильный Campylobacter spp. 5’GCCCTAAGCGTCCTTCCA 3; и C. jejuni 5’; AGCTAACCACACCTTATACCG 3’).

Слайды рассматривались с флюоресцентной подсветкой на микроскопе DMRB (Leica), укомплектованном камерой Retiga EXi (QImaging) с программным обеспечением для визуализации Volocity (PerkinElmer) на предмет проявления нейтрофильной эластазы кошек и Кампилобактерий. Снимок производился, когда в поле зрения (увеличение ×400) был виден экспрессор нейтрофильной эластазы и один или оба экспрессора Кампилобактерий. Также производилась запись о любом экспрессоре нейтрофильной эластазы, когда в поле зрения не было ни экспрессоров Камбилобактерий, ни следов присутствия C. jejuni или термофильных Кампилобактерий. Снимки были обработаны с помощью сервиса Image J (http://rsb.info.nih.gov/ij), чтобы автоматически измерить дистанцию между точками, выбранными пользователем — нейтрофилами и Кампилобактериями. Расстояние измерялось в пикселях на цифровых снимках. Максимальным размером поля было выбрано 1850 пикселей. Использование этого сервиса позволило произвести множество точных измерений, необходимых для статистического анализа.

 

Статистика

 

Анализ производился с помощью специального программного обеспечения — GraphPad Prism version 5.03. Присутствие бактерий у кошек с нейтрофильным и лимфоплазмоцитарным ВЗК сравнивалось и проверялось на статистическую значимость по критерию хи-квадрата.

Различия между группой с нейтрофильным воспалением и группой с лимфоплазмоцитарным воспалением в количестве бактерий разных видов, найденных в тканях, анализировались по U-критерию Манна–Уитни. По тому же принципу анализировалась разница в дистанции между C. jejuni и нейтрофилами и C. coli и нейтрофилами.

 

Результаты

 

15 кошек (11 котов и 4 кошки) подошли по критериям: восемь из них были домашними короткошёрстными (DSH), одна — домашней длинношерстной (DLH), и пять кошек были чистокровными (мейн-кун, две сиамских, бирманская, ориентальная). У одного из образцов биопсии порода была не указана. Возраст кошек был от 2 до 15 лет (в среднем 9). Исследование бактериальной ДНК показало, что ни у кого из кошек не было Сальмонелл или патогенных генотипов E. coli (как было сказано ранее, нельзя при этом исключать наличие AIEC). Одно животное в каждой группе (нейтрофильное и лимфоплазмацитарное воспаление) имело положительные результаты на наличие Клостридий. Все животные имели положительный результат на наличие Кампилобактерий. Секвенирование последовательностей на предмет идентификации Кампилобактерий выявило, что найти C. lari и C. Upsaliensis не удаётся. В тканях присутствовали только виды C. coli и C. jejuni. Результаты анализов с помощью ПЦР и FISH совпадали (илл. 1).

 

Илл. 1. А — количество C. jejuni в слизистой кошек с нейтрофильным ВЗК и у кошек с лимфоплазмоцитарным ВЗК. В — количество C. coli в слизистой кошек с нейтрофильным ВЗК и у кошек с лимфоплазмоцитарным ВЗК. С — частота появления C. jejuni в слизистой кошек с нейтрофильным ВЗК и у кошек с лимфоплазмоцитарным ВЗК. D — частота появления C. jejuni в слизистой кошек с нейтрофильным ВЗК и у кошек с лимфоплазмоцитарным ВЗК

 

 

Наличие бактерий у кошек с нейтрофильным ВЗК и у кошек с лимфоплазмоцитарным ВЗК

 

Бактерии были найдены и у кошек с нейтрофильным воспалением, и у кошек с лимфоплазмоцитарным воспалением. Значительной разницы в количестве Эубактерий, найденных в обеих группах, не наблюдалось. Было найдено лишь незначительное количество C. upsaliensis, и дальнейший статистический анализ проводить не было смысла. C. jejuni и C. coli обнаружились в большем количестве, поэтому их распределение между группами было проанализировано. Значительной разницы в количестве C. jejuni в слизистой между группами не было. Однако C. coli в большем количестве присутствовал у кошек с нейтрофильным воспалением (6/7), чем у кошек с лимфоплазмоцитарным (1/8), и разница оказалась значительной (P = 0,009) (илл. 1).

 

Количество бактерий у кошек с нейтрофильным ВЗК и у кошек с лимфоплазмоцитарным ВЗК

 

Сравнивалось количество C. jejuni и C. coli в слизистой у кошек с нейтрофильным воспалением и у кошек с лимфоплазмоцитарным воспалением. Для C. jejuni цифры были примерно равны в обеих группах, и значительной разницы в распределении не наблюдалось. Для C. coli значения оказались больше у кошек с нейтрофильным воспалением (среднее количество бактерий в поле высокого увеличения (×400) составило 0,7), в сравнении с кошками с лимфоплазмоцитарным воспалением среднее количество бактерий в поле высокого увеличения (×400) составило 0), и разница была значительной (P = 0,002) (илл. 1).

 

Локализация бактерий и нейтрофилов

 

В слизистой кошек с лимфоплазмоцитарным воспалением количество нейтрофилов было небольшим, чтобы оценить их соседство с бактериями — на 62 из 63 полях зрения не удалось найти нейтрофилов и Кампилобактерий в пределах одного поля зрения. В слизистой кошек с нейтрофильным воспалением такой результат был только на 6 из 63 полей. Клетки экспрессии нейтрофильной эластазы имели обычную полиморфноядерную структуру на световом микроскопе.

В слизистой кошек с нейтрофильным воспалением было проанализировано соседство C. jejuni и C. Coli; количество C. Upsaliensis было недостаточно для анализа. Для C. jejuni не было выявлено никакой очевидной связи в локализации бактерий и нейтрофилов, и часто они не обнаруживались в одном и том же поле зрения вместе (>1850 пикселей). Для C. coli такая связь прослеживалась — P < 0,001 (илл. 2).

 

Илл. 2. Расстояние между Campylobacter coli и нейтрофилами значительно меньше, чем между нейтрофилами и C. jejuni. Значения показывают расстояние между Campylobacter coli и нейтрофилами, измерено с помощью сервиса ImageJ. Максимальное расстояние между краями полей зрения равно 1850 пикселям. Если в одном поле зрения Campylobacter coli и нейтрофилы не обнаруживаются одновременно, расстояние записывается равным 1850 пикселям

 

 

Обсуждение

 

Воспалительное расстройство кишечника — одна из причин хронических симптомов желудочно-кишечных заболеваний у кошек, наряду с негативной реакцией на еду, энтеропатией при антибиотикотерапии и инфекцией (вирусы, грибы, бактерии, простейшие, паразиты). Случаи с гистологическими изменениями в результате нейтрофильного воспаления могут возникать вследствие инвазии микроорганизмов, быть вторичными после повреждения слизистой или инфекции Tritrichomonas foetus, или быть идиопатическими. Целью данного исследования было с помощью FISH выяснить, присутствует инвазия микроорганизмов в слизистой кишечника при кошачьем ВЗК, и выявить любую связь между инвазией Кампилобактерий и нейтрофильным воспалением (фото 1).

 

Фоо 1. Флюоресцентная гибридизация in situ (FISH) демонстрирует красную флюоресценцию для термофильных Кампилобактерий (C. coli) и голубую для нейтрофильной эластазы. Подсвечены не все бактерии, поскольку организмы вне фокуса не видны на одной картинке

 

 

Бактерии выявлялись у кошек с обоими типами воспаления, свидетельствуя об увеличении проницаемости слизистой. В их распределении по тканям не было какой-либо закономерности (слизистая, подслизистая, собственная пластинка). Общее число бактерий было приблизительно одинаковое в обеих группах, и для двух видов (C. jejuni и C. upsaliensis) между группами не было выявлено значительной разницы в распределении. Значительная разница была отмечена в распределении бактерий C. coli. Само по себе это только наблюдение, и оно лишь демонстрирует, что у кошек с нейтрофильным воспалением присутствует больше C. coli. Тем не менее пробы FISH демонстрируют близкую расположенность к нейтрофилам и их возможную ассоциацию с C. coli. Связи между локализацией нейтрофилов и других бактерий нам обнаружить не удалось. Эта связь доказывает, что есть частичная ассоциация инфекции C. coli со специфичным нейтрофильным воспалением в слизистой двенадцатиперстной кишки у кошек с энтеритом по сравнению с другими микроорганизмами.

Род Campylobacter известен своим свойством сильной хемоаттракции для нейтрофилов. Предыдущие исследования in vitro на клетках свиного и человеческого эпителия показали, что C. jejuni и C. coli запускают нейтрофильное воспаление слизистой через активацию ядерного фактора «каппа-би» (NF-B) и последующую продукцию нейтрофильного ИЛ-8, а также вызывают миграцию нейтрофилов сквозь эпителий через продукцию хемотаксических n-formyl пептидов и метаболитов 12-липоксигеназы [18, 19]. В данном ретроспективном исследовании были получены свидетельства того, что C. coli, но не C. jejuni оказываются близки по локализации с нейтрофилами и, следовательно, могут являться этиологическим агентом в этом конкретном варианте ВЗК, хотя в процесс также могут быть вовлечены и другие клетки и механизмы. В исследованиях in vitro с кошачьими нейтрофилами так же, как и в предыдущих исследованиях с нейтрофилами свиней [18, 19], необходимо выявлять механизм хемоаттракции.

Ограничения исследования в основном связаны с его ретроспективным анализом и нехваткой исходных клинических данных. Кроме того, под критерии включения подошло так мало образцов, поскольку многие другие не удовлетворяли качеству и количеству требуемого материала.

Мы не смогли задокументировать различия в клиническом проявлении в двух группах или получить доступ к данным, связанным с лечением и исходом, поскольку не все эти животные проходили полный курс лечения непосредственно в нашем госпитале; образцы были взяты из нашего архива, и наши цели свелись к выявлению связи между бактериями и заболеванием. Нехватка клинических данных также означает, что нам неизвестно, принимали ли исследуемые животные антибиотики перед проведением биопсии. Этот фактор может сильно повлиять на результаты, однако предшествующий приём антибиотиков очевидно сильно снизил бы общее количество бактерий, а следовательно, и вероятность увидеть значительную разницу между группами в их распределении, если исключить вероятность того, что все кошки с лимфоплазмоцитарным воспалением получали антибиотикотерапию, а все кошки с нейтрофильным — нет. Кроме того, анализ кала мог оказаться очень полезен в выявлении Campylobacter spp. Последующие за этим трудом исследования должны оценить клинические и терапевтические факторы.

Гистологическая классификация и последующий анализ выполнялись на образцах с биопсии и могут не отражать природу воспалительных изменений в остальных отделах ЖКТ. Предыдущее исследование [20] на собаках с энтеропатией показало, что изменения слизистой двенадцатиперстной кишки и подвздошной кишки могут сильно гистологически отличаться. Другое исследование [21] так же продемонстрировало слабую связь между гистологическими картинами с биопсий из подвздошной и двенадцатиперстной кишки; но, несмотря на эти различия, лимфоплазмоцитарное воспаление гораздо меньше отличается от микроклеточной лимфомы, чем от нейтрофильного воспаления. Хотя и существует вероятность, что воспалительные изменения в других участках ЖКТ будут отличаться от образцов из двенадцатиперстной кишки, наша гипотеза связана с инфекционной этиологией локализованного нейтрофильного воспаления, так что наши находки остаются достоверными.

Предварительные выводы из данного исследования подчёркивают необходимость продолжения изучений данного вопроса с целью выявить связь локализации C. coli в тканях с характером воспаления. Это позволить понять, отличается ли у таких кошек клинические проявления и оценка по шкале FCEAI и их эндоскопическая картина. Выявление C. coli как этиологического фактора позволит точнее подбирать тактику лечения и потенциально улучшит клинический прогноз и снизит зоонозный риск [8, 22]. Дальнейшие молекулярные исследования in vitro помогут понять, каким образом C. coli индуцирует нейтрофильный ответ: производит ли он соединения, стимулирующие нейтрофилы, или же заставляет клетки кишечника кошки производить нейтрофильные хемоаттрактанты. Кроме того, исследования в этой области могут выявить факторы риска для хозяев этих животных.

 

 

Литература

1. Hall EJ, German AJ. Diseases of the small intestine. In: Ettinger SJ, Feldman EC, eds. Textbook of Veterinary Internal Medicine, 7th ed. St.Louis, MO: Elsevier Saunders; 2010:1526–1572.

2. Washabau RJ, Day MJ, Willard MD, et al. Endoscopic, biopsy, and histopathological guidelines for the evaluation of gastrointestinal inflammation in companion animals. J Vet Intern Med 2010;24:10–26.

3. Willard MD. Feline inflammatory bowel disease: A review. J Feline Med Surg 1999;1:155–164.

4. Yaegar MJ, Gookin JL. Histologic features associated with Tritrichomonas foetus-induced colitis in domestic cats. Vet Pathol 2005;42:797–804.

5. Leib MS, Sponenberg DP, Wilcke JR, et al. Suppurative colitis in a cat. J Am Vet Med Assoc 1986;188:739–741.

6. Acke E, Whyte P, Jones BR, et al. Prevalence of thermophilic Campylobacter species in cats and dogs in two animal shelters in Ireland. Vet Rec 2006;158:51–54.

7. Hill SL, Cheney JM, Taton-Allen GF, et al. Prevalence of enteric zoonotic organisms in cats. J Am Vet Med Assoc 2000;216:687–692.

8. Marks SL, Rankin SC, Byrne BA, et al. Enteropathogenic bacteria in dogs and cats: Diagnosis, epidemiology, treatment and control. ACVIM Consensus statement. J Vet Intern Med 2011;25:1195–1208.

9. Rossi M, Hänninen ML, Revez J, et al. Occurrence and species level diagnostics of Campylobacter spp., enteric Helicobacter spp. and Anaerobiospirillum spp. in healthy and diarrheic dogs and cats. Vet Microbiol 2008;129:304–314.

10. Simpson KW. Bacteria and inflammatory bowel disease: causes and consequences. Proceedings of the 33rd World Small Animal Veterinary Association Congress Dublin, Ireland 2008. Available at: http://www.vin.com/members/cms/project/defaultadv1.aspx?pId=11268&meta=VIN&catId=32729&id=3866515. Accessed April 15, 2015.

11. Jergens A, Pressel M, Crandell J, et al. Fluorescence in situ hybridization confirms clearance of visible Helicobacter spp. associated with gastritis in dogs and cats. J Vet Intern Med 2009;23:16–23.

12. Simpson KW, Dogan B, Rishniw M, et al. Adherent and invasive Escherichia coli is associated with granulomatous colitis in boxer dogs. Infect Immun 2006;74:4778–4792.

13. Mansfield CS, James FE, Craven M, et al. Remission of histiocytic ulcerative colitis in Boxer dogs correlates with eradication of invasive intramucosal Escherichia coli. J Vet Intern Med 2009;23:964–969.

14. Janeczko S, Atwater D, Bogel E, et al. The relationship of mucosal bacteria to duodenal histopathology, cytokine mRNA and clinical disease activity in cats with inflammatory bowel disease. Vet Microbiol 2008;128:178–193.

15. Day MJ, Bilzer T, Mansell J, et al. Histopathological standards for the diagnosis of gastrointestinal inflammation in endoscopic biopsy samples from the dog and cat: A report from the World Small Animal Veterinary Association gastrointestinal standardization group. J Comp Pathol 2008;138(Supplement 1):S1–S43.

16. Jennings JL, Sait LC, Perrett CA, et al. Campylobacter jejuni is associated with, but not sufficient to cause vibrionic hepatitis in chickens. Vet Microbiol 2011;149:193–199.

17. Van Doorn LJ, Verschuuren-van Haperen A, Burnens A, et al. Rapid identification of thermotolerant Campylobacter jejuni, Campylobacter coli, Campylobacter lari, and Campylobacter upsaliensis from various geographic locations by a GTPase-based PCR-reverse hybridization assay. J Clin Microbiol 1999;37:1790–1796.

18. Murphy H, Cogan T, Hughes R, et al. Porcine intestinal epithelial responses to Campylobacter infection. Comp Immunol Microbiol Infect Dis 2011;34:489–495.

19. Murphy H, Cogan T. Humphrey. Direction of neutrophil movements by Campylobacter-infected intestinal epithelium. Microbes Infect 2011;13:42–48.

20. Casamian-Sorrosal D, Willard MD, Murray JK, et al. Comparison of the histopathologic findings in biopsies from the duodenum and ileum of dogs with enteropathy. J Vet Intern Med 2010;2010:80–83.

21. Scott KD, Zoran DL, Mansell J, et al. Utility of endoscopic biopsies of the duodenum and ileum for diagnosis of inflammatory bowel disease and small cell lymphoma in cats. J Vet Intern Med 2011;25:1253–1257.

22. Fox JG. Enteric bacterial infections: Campylobacter. In: Greene CE, ed. Infectious Diseases of the Dog and Cat, 3rd ed. St.Louis, MO: Elsevier Saunders; 2006:339–343.

 

Авторское разрешение на перевод и публикацию данного материала получено.

 

СВМ № 1/2017

 

 

 

 

 

 

 

Пожалуйста, авторизуйтесь или зарегистрируйтесь, чтобы оставить комментарий.
КОММЕНТАРИИ
Календарь мероприятий